Review



2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc 2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector
    2026 Bbsi Digested Px330 U6 Chimeric Bb Cbh Hspcas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3002 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41572572-57-44-53
    Average 96 stars, based on 3002 article reviews
    2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: BAG6 prevents the aggregation of neurodegeneration-associated fragments of TDP43.
    Article Snippet: .. Briefly, pJH551, a plasmid encoding a human codon-optimized SpCas9 and a chimeric guide RNA targeting the exon 4 of human BAG6 gene, was constructed by the ligation of a double strand oligomer (made by the denaturation and renaturation of CB521F and CB522R) into BbsI digested pX330 (pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang; Addgene plasmid # 42230). ..

    Article Title: Nhlh1 and Nhlh2, a global transcriptional mechanism regulating commissural axon projection via activating Robo3
    Article Snippet: .. For generating sgRNA for gene editing in fertilized eggs, oligonucleotide pairs were annealed and cloned into BbsI digested pX330 (Addgene, Plasmid#42230): for Nhlh1-sg1, 5’CACC GGACCGGGCCCCGATGGTGC 3’ and 5’AAAC GCACCATCGGGGCCCGGTCC 3’; for Nhlh1-sg2, 5’CACCGCTAGGTTGAAGGCTTCCACG3’ and 5’AAAC CGTGGAAGCCTTCAACCTAGC 3’; for Nhlh2-sg1, 5’CACCGCGAAGAAAAGCGCCGCCGC3’ and 5’AAACGCGGCGGCGCTTTTCTTCGC3’; for Nhlh2-sgRNA2, 5’CACCG TTCTTGTCCGGAGGCAGCGT 3’ and 5’AAAC ACGCTGCCTCCGGACAAGAA C3’. ..

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Article Title: Development of an isogenic human cell trio that models polyglutamine disease.
    Article Snippet: Genomic DNA isolation From the original and modified HCT116 cell clones, genomic DNA was isolated using the Monarch Genomic DNA Purification kit (New England Biolabs). .. Plasmid construction We constructed the gRNA expression vector by inserting annealed oligonucleotides including target sequences and adaptor sequences into BbsI-digested pX330 (Addgene plasmid #42230) (Cong et al., 2013). ..

    Article Title: The FANCM-RMI1/2 complex promotes genomic instability and PARP inhibitor sensitivity in BRCA2-deficicient cells
    Article Snippet: .. Single gRNA expression plasmids (pFD144 and pFD146) to induce CAS9-dependent DSBs at the start codons of Brca1 and Brca2 , respectively, were cloned by ligating annealed DNA duplexes corresponding to the target gRNA sequences into BbsI-digested pX330 (gift from Feng Zhang, Addgene plasmid 42230). ..

    Article Title: Functional profiling reveals a non-enzymatic role of NUDT5 in repressing purine de novo synthesis
    Article Snippet: sgRNAs were designed using the online resource tool provided by Benchling ( https://benchling.com , 2023) and purchased as short single-stranded DNA oligos with BbsI sticky ends. .. Oligonucleotides were phosphorylated, annealed and cloned into BBsI digested pX330 (mcherry selection, a gift from Ralf Kuehn, Addgene plasmid # 64324) or pX459 (puromycin selection, a gift from Feng Zhang, Addgene plasmid # 62988) backbone according to published procedures ( https://portals.broadinstitute.org/gpp/public/ ). ..

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Materials and Methods Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Construct:

    Article Title: BAG6 prevents the aggregation of neurodegeneration-associated fragments of TDP43.
    Article Snippet: .. Briefly, pJH551, a plasmid encoding a human codon-optimized SpCas9 and a chimeric guide RNA targeting the exon 4 of human BAG6 gene, was constructed by the ligation of a double strand oligomer (made by the denaturation and renaturation of CB521F and CB522R) into BbsI digested pX330 (pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang; Addgene plasmid # 42230). ..

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Article Title: Development of an isogenic human cell trio that models polyglutamine disease.
    Article Snippet: Genomic DNA isolation From the original and modified HCT116 cell clones, genomic DNA was isolated using the Monarch Genomic DNA Purification kit (New England Biolabs). .. Plasmid construction We constructed the gRNA expression vector by inserting annealed oligonucleotides including target sequences and adaptor sequences into BbsI-digested pX330 (Addgene plasmid #42230) (Cong et al., 2013). ..

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Materials and Methods Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Ligation:

    Article Title: BAG6 prevents the aggregation of neurodegeneration-associated fragments of TDP43.
    Article Snippet: .. Briefly, pJH551, a plasmid encoding a human codon-optimized SpCas9 and a chimeric guide RNA targeting the exon 4 of human BAG6 gene, was constructed by the ligation of a double strand oligomer (made by the denaturation and renaturation of CB521F and CB522R) into BbsI digested pX330 (pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang; Addgene plasmid # 42230). ..

    Clone Assay:

    Article Title: Nhlh1 and Nhlh2, a global transcriptional mechanism regulating commissural axon projection via activating Robo3
    Article Snippet: .. For generating sgRNA for gene editing in fertilized eggs, oligonucleotide pairs were annealed and cloned into BbsI digested pX330 (Addgene, Plasmid#42230): for Nhlh1-sg1, 5’CACC GGACCGGGCCCCGATGGTGC 3’ and 5’AAAC GCACCATCGGGGCCCGGTCC 3’; for Nhlh1-sg2, 5’CACCGCTAGGTTGAAGGCTTCCACG3’ and 5’AAAC CGTGGAAGCCTTCAACCTAGC 3’; for Nhlh2-sg1, 5’CACCGCGAAGAAAAGCGCCGCCGC3’ and 5’AAACGCGGCGGCGCTTTTCTTCGC3’; for Nhlh2-sgRNA2, 5’CACCG TTCTTGTCCGGAGGCAGCGT 3’ and 5’AAAC ACGCTGCCTCCGGACAAGAA C3’. ..

    Article Title: The FANCM-RMI1/2 complex promotes genomic instability and PARP inhibitor sensitivity in BRCA2-deficicient cells
    Article Snippet: .. Single gRNA expression plasmids (pFD144 and pFD146) to induce CAS9-dependent DSBs at the start codons of Brca1 and Brca2 , respectively, were cloned by ligating annealed DNA duplexes corresponding to the target gRNA sequences into BbsI-digested pX330 (gift from Feng Zhang, Addgene plasmid 42230). ..

    Article Title: ID3 is a novel target gene of p53 and modulates lung cancer cell metastasis.
    Article Snippet: The tumor suppressor p53 prevents cancer development by regulating dozens of target genes with diverse biological functions.. Although numerous p53 target genes have been identified to date, the dynamics and function of the regulatory network centered on p53 have not yet been fully elucidated.. We herein identified inhibitor of DNAbinding/differentiation-3 (ID3) as a direct p53 target gene. p53 bound the distal promoter of ID3 and positively regulated its transcription.

    Article Title: Functional profiling reveals a non-enzymatic role of NUDT5 in repressing purine de novo synthesis
    Article Snippet: sgRNAs were designed using the online resource tool provided by Benchling ( https://benchling.com , 2023) and purchased as short single-stranded DNA oligos with BbsI sticky ends. .. Oligonucleotides were phosphorylated, annealed and cloned into BBsI digested pX330 (mcherry selection, a gift from Ralf Kuehn, Addgene plasmid # 64324) or pX459 (puromycin selection, a gift from Feng Zhang, Addgene plasmid # 62988) backbone according to published procedures ( https://portals.broadinstitute.org/gpp/public/ ). ..

    Expressing:

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Article Title: Development of an isogenic human cell trio that models polyglutamine disease.
    Article Snippet: Genomic DNA isolation From the original and modified HCT116 cell clones, genomic DNA was isolated using the Monarch Genomic DNA Purification kit (New England Biolabs). .. Plasmid construction We constructed the gRNA expression vector by inserting annealed oligonucleotides including target sequences and adaptor sequences into BbsI-digested pX330 (Addgene plasmid #42230) (Cong et al., 2013). ..

    Article Title: The FANCM-RMI1/2 complex promotes genomic instability and PARP inhibitor sensitivity in BRCA2-deficicient cells
    Article Snippet: .. Single gRNA expression plasmids (pFD144 and pFD146) to induce CAS9-dependent DSBs at the start codons of Brca1 and Brca2 , respectively, were cloned by ligating annealed DNA duplexes corresponding to the target gRNA sequences into BbsI-digested pX330 (gift from Feng Zhang, Addgene plasmid 42230). ..

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Materials and Methods Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Sequencing:

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Article Title: ID3 is a novel target gene of p53 and modulates lung cancer cell metastasis.
    Article Snippet: The tumor suppressor p53 prevents cancer development by regulating dozens of target genes with diverse biological functions.. Although numerous p53 target genes have been identified to date, the dynamics and function of the regulatory network centered on p53 have not yet been fully elucidated.. We herein identified inhibitor of DNAbinding/differentiation-3 (ID3) as a direct p53 target gene. p53 bound the distal promoter of ID3 and positively regulated its transcription.

    Article Title: Scarless genome editing through two-step homology directed repair
    Article Snippet: In summary, our method addresses multiple bottlenecks in generating human pluripotent cells with scarless genome editing thus advancing stem cell technologies as disease and developmental models, drug screening tools, and therapeutics. .. Materials and Methods Plasmid sgRNA expression vectors were constructed by insertion of annealed oligonucleotide including target sequences and adapter sequence into BbsI digested px330 (Addgene plasmid #42230) containing a human codon-optimized SpCas9 expression cassette and a human U6 promoter driving the expression of the chimeric sgRNA. ..

    Selection:

    Article Title: Functional profiling reveals a non-enzymatic role of NUDT5 in repressing purine de novo synthesis
    Article Snippet: sgRNAs were designed using the online resource tool provided by Benchling ( https://benchling.com , 2023) and purchased as short single-stranded DNA oligos with BbsI sticky ends. .. Oligonucleotides were phosphorylated, annealed and cloned into BBsI digested pX330 (mcherry selection, a gift from Ralf Kuehn, Addgene plasmid # 64324) or pX459 (puromycin selection, a gift from Feng Zhang, Addgene plasmid # 62988) backbone according to published procedures ( https://portals.broadinstitute.org/gpp/public/ ). ..



    Similar Products

    96
    Addgene inc 2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector
    2026 Bbsi Digested Px330 U6 Chimeric Bb Cbh Hspcas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41572572-57-44-53
    Average 96 stars, based on 1 article reviews
    2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested px330
    Bbsi Digested Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__64898__2026__01__15__699681-206-35-41
    Average 96 stars, based on 1 article reviews
    bbsi digested px330 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested px330 plasmid
    Bbsi Digested Px330 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__2025__10__06__680635-173-10-14
    Average 96 stars, based on 1 article reviews
    bbsi digested px330 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested px330 u6 chimeric bb cbh hspcas9
    Bbsi Digested Px330 U6 Chimeric Bb Cbh Hspcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc12284375-192-41-46
    Average 96 stars, based on 1 article reviews
    bbsi digested px330 u6 chimeric bb cbh hspcas9 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested puc19 sgrnaopt
    Bbsi Digested Puc19 Sgrnaopt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px330/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc10277887__mmc5-156-11-21
    Average 96 stars, based on 1 article reviews
    bbsi digested puc19 sgrnaopt - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results